ID: 1189953887_1189953890

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1189953887 1189953890
Species Human (GRCh38) Human (GRCh38)
Location X:46259091-46259113 X:46259108-46259130
Sequence CCATCTTCCCTTTTCTTTATCAA TATCAACCACGTGTACAGTAAGG
Strand - +
Off-target summary {0: 2, 1: 41, 2: 121, 3: 274, 4: 1164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!