ID: 1190059844_1190059848

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1190059844 1190059848
Species Human (GRCh38) Human (GRCh38)
Location X:47203554-47203576 X:47203577-47203599
Sequence CCATTGGCTGTGAGCTGCTCAAG AACTTTGCCATGATTGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 247} {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!