ID: 1190063928_1190063938

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1190063928 1190063938
Species Human (GRCh38) Human (GRCh38)
Location X:47227424-47227446 X:47227473-47227495
Sequence CCATTCTTCCTCAGTCTGGGGGA AGTGGAGCTGGGGAATGGACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 304} {0: 1, 1: 0, 2: 1, 3: 44, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!