ID: 1190117966_1190117981

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1190117966 1190117981
Species Human (GRCh38) Human (GRCh38)
Location X:47638128-47638150 X:47638176-47638198
Sequence CCACATTAAGCTCTTCCGATTTC GGATGACCTGGTAGAGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95} {0: 1, 1: 0, 2: 3, 3: 23, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!