ID: 1190157885_1190157895

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1190157885 1190157895
Species Human (GRCh38) Human (GRCh38)
Location X:48008355-48008377 X:48008381-48008403
Sequence CCTCCCTTCTCCCTGCCCCAGGG TGCATGGCTCATTATGAGAGTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 22, 3: 179, 4: 1255} {0: 2, 1: 0, 2: 2, 3: 5, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!