ID: 1190181179_1190181190

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1190181179 1190181190
Species Human (GRCh38) Human (GRCh38)
Location X:48194136-48194158 X:48194189-48194211
Sequence CCCACGGTTAGGGTCATTATCAA TATTACGCATGAAAGGTGGGAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 3, 3: 9, 4: 32} {0: 1, 1: 11, 2: 2, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!