ID: 1190222378_1190222383

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1190222378 1190222383
Species Human (GRCh38) Human (GRCh38)
Location X:48520685-48520707 X:48520705-48520727
Sequence CCTGCTGGGGCCTAGAGGGGGAT GATGCTTGGGGAAACAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 147} {0: 1, 1: 0, 2: 0, 3: 35, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!