ID: 1190277204_1190277212

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1190277204 1190277212
Species Human (GRCh38) Human (GRCh38)
Location X:48906499-48906521 X:48906536-48906558
Sequence CCAGGACAGCCTCATGGAGGAAG CACGTTACCTAGGTGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 487} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!