ID: 1190325564_1190325584

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1190325564 1190325584
Species Human (GRCh38) Human (GRCh38)
Location X:49205032-49205054 X:49205081-49205103
Sequence CCCCCAGTGCAAAGACAACAAAA CCTGCTGGGGAGGGGAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 598} {0: 2, 1: 1, 2: 18, 3: 233, 4: 1660}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!