ID: 1190327352_1190327360

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1190327352 1190327360
Species Human (GRCh38) Human (GRCh38)
Location X:49215022-49215044 X:49215044-49215066
Sequence CCAAGGGATTATGTGGAGATAAT TAGGGTCAGGAGTCTGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 178} {0: 1, 1: 0, 2: 6, 3: 12, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!