ID: 1190379742_1190379748

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1190379742 1190379748
Species Human (GRCh38) Human (GRCh38)
Location X:49828373-49828395 X:49828418-49828440
Sequence CCACATTGACTTAGCAGGGCTCT GGAAATGCACAGATGGGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 127} {0: 3, 1: 34, 2: 59, 3: 87, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!