ID: 1190543963_1190543966

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1190543963 1190543966
Species Human (GRCh38) Human (GRCh38)
Location X:51505700-51505722 X:51505737-51505759
Sequence CCTTGTGAAGGGATAAAATGATT CTTCAAGGTCCTGTTGAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!