ID: 1190554760_1190554772

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1190554760 1190554772
Species Human (GRCh38) Human (GRCh38)
Location X:51623054-51623076 X:51623107-51623129
Sequence CCCTCTTTCAATTACCTGCAAAT GAGGTATTTAAAACTTTCTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!