ID: 1190601537_1190601542

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1190601537 1190601542
Species Human (GRCh38) Human (GRCh38)
Location X:52097827-52097849 X:52097865-52097887
Sequence CCAGTAGCAGACCAAGAGCTGTT AATTATCTGAGGATAATGGCAGG
Strand - +
Off-target summary {0: 3, 1: 11, 2: 59, 3: 255, 4: 357} {0: 1, 1: 1, 2: 2, 3: 184, 4: 2497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!