ID: 1190610161_1190610175

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1190610161 1190610175
Species Human (GRCh38) Human (GRCh38)
Location X:52185351-52185373 X:52185398-52185420
Sequence CCCACTCCATCCGCCTCTAGTGC CCCCGCCCGGACCTAGCCAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 132} {0: 2, 1: 0, 2: 2, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!