ID: 1190637099_1190637113

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1190637099 1190637113
Species Human (GRCh38) Human (GRCh38)
Location X:52446146-52446168 X:52446194-52446216
Sequence CCTTCCTCCCTCTGGCTCCCCTT GGTTTGGCAAGTTAGCCTTATGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 26, 3: 235, 4: 1647} {0: 2, 1: 0, 2: 1, 3: 4, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!