ID: 1190652256_1190652261

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1190652256 1190652261
Species Human (GRCh38) Human (GRCh38)
Location X:52578445-52578467 X:52578467-52578489
Sequence CCCTGAACAAAGGGATCAATCAC CCTTTTAAGTAGTTTGTGGCGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 2, 3: 17, 4: 168} {0: 2, 1: 4, 2: 6, 3: 27, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!