ID: 1190681736_1190681744

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1190681736 1190681744
Species Human (GRCh38) Human (GRCh38)
Location X:52831669-52831691 X:52831709-52831731
Sequence CCAGGGACTGGCCAGGCAGCCAA TGGACTTGTGGTGCCTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 220} {0: 2, 1: 13, 2: 66, 3: 102, 4: 2347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!