ID: 1190695136_1190695141

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1190695136 1190695141
Species Human (GRCh38) Human (GRCh38)
Location X:52943973-52943995 X:52943988-52944010
Sequence CCCTCCTCTATAGTCTAAAAGAA TAAAAGAATCTGTGAAGGGTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 24, 4: 207} {0: 2, 1: 0, 2: 2, 3: 34, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!