ID: 1190736485_1190736489

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1190736485 1190736489
Species Human (GRCh38) Human (GRCh38)
Location X:53258729-53258751 X:53258752-53258774
Sequence CCTGAAATCTCCTGCTGAGGCAG GAGAATCACTTGAATCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 23, 4: 240} {0: 1313, 1: 26071, 2: 72097, 3: 129739, 4: 160135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!