ID: 1190759521_1190759530

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1190759521 1190759530
Species Human (GRCh38) Human (GRCh38)
Location X:53427986-53428008 X:53428028-53428050
Sequence CCTTTCTTTGGGATCAGGTGGAT AGGTGGGAGACCGAAAGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 348} {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!