|
Left Crispr |
Right Crispr |
Crispr ID |
1190778799 |
1190778807 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
X:53577542-53577564
|
X:53577578-53577600
|
Sequence |
CCTTCCATGGTCTCCCTCTGATG |
GGACGGTACTGCTGCCATCTCGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 89, 2: 14, 3: 27, 4: 216} |
{0: 125, 1: 829, 2: 365, 3: 139, 4: 530} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|