ID: 1190778799_1190778807

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1190778799 1190778807
Species Human (GRCh38) Human (GRCh38)
Location X:53577542-53577564 X:53577578-53577600
Sequence CCTTCCATGGTCTCCCTCTGATG GGACGGTACTGCTGCCATCTCGG
Strand - +
Off-target summary {0: 4, 1: 89, 2: 14, 3: 27, 4: 216} {0: 125, 1: 829, 2: 365, 3: 139, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!