ID: 1190862622_1190862641

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1190862622 1190862641
Species Human (GRCh38) Human (GRCh38)
Location X:54358632-54358654 X:54358674-54358696
Sequence CCCCCGCCCCCCAGGACCGCAGT GAAACGACCAAAGCAGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 292} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!