ID: 1191095706_1191095708

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1191095706 1191095708
Species Human (GRCh38) Human (GRCh38)
Location X:56671167-56671189 X:56671194-56671216
Sequence CCAGTAATAGGCCAAGAACTGTC AAAAGAAGAGTAGTTATCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!