ID: 1191803813_1191803817

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1191803813 1191803817
Species Human (GRCh38) Human (GRCh38)
Location X:65111748-65111770 X:65111793-65111815
Sequence CCACAAACCATGCCCATATAAGA TGTGTGTTCTGATTACTCCATGG
Strand - +
Off-target summary {0: 25, 1: 61, 2: 188, 3: 315, 4: 547} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!