ID: 1192127213_1192127216

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1192127213 1192127216
Species Human (GRCh38) Human (GRCh38)
Location X:68513161-68513183 X:68513181-68513203
Sequence CCTACCTCTCTGGTTTGTTTGTG GTGTAGTGAAGGAGTTGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 353} {0: 1, 1: 0, 2: 1, 3: 14, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!