ID: 1192211228_1192211232

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1192211228 1192211232
Species Human (GRCh38) Human (GRCh38)
Location X:69129127-69129149 X:69129154-69129176
Sequence CCTCTCCTCTCTCTTGAGTCTGT GGTCCTGGTGCTTAGCTGCGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!