ID: 1192343730_1192343736

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1192343730 1192343736
Species Human (GRCh38) Human (GRCh38)
Location X:70284225-70284247 X:70284259-70284281
Sequence CCCTTTTTTTTTTTTTGGTCCCC CACACAGCTGTTCCGGCGTGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 64, 3: 467, 4: 3105} {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!