ID: 1192440408_1192440416

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1192440408 1192440416
Species Human (GRCh38) Human (GRCh38)
Location X:71169799-71169821 X:71169833-71169855
Sequence CCGGGGCCCCGGAGTTGGGAGCT GGAGCTGGCAGCATTACAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 358} {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!