ID: 1192440411_1192440416

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1192440411 1192440416
Species Human (GRCh38) Human (GRCh38)
Location X:71169807-71169829 X:71169833-71169855
Sequence CCGGAGTTGGGAGCTGCTCCAGA GGAGCTGGCAGCATTACAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 157} {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!