ID: 1192520475_1192520484

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1192520475 1192520484
Species Human (GRCh38) Human (GRCh38)
Location X:71796251-71796273 X:71796283-71796305
Sequence CCCAGGCTCCAGACTGGTCCCAT GCTCCCTCAGCCCTAGACTCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 39, 4: 275} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!