ID: 1192667296_1192667300

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1192667296 1192667300
Species Human (GRCh38) Human (GRCh38)
Location X:73101454-73101476 X:73101483-73101505
Sequence CCAAAGGCAGAGAAACATCACTC CACTACCACCCCAGGCCCTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!