ID: 1192705538_1192705543

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1192705538 1192705543
Species Human (GRCh38) Human (GRCh38)
Location X:73526067-73526089 X:73526080-73526102
Sequence CCTGGCTTCAGGGATCCTACAGG ATCCTACAGGTCCCGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 292} {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!