ID: 1193093554_1193093556

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1193093554 1193093556
Species Human (GRCh38) Human (GRCh38)
Location X:77521804-77521826 X:77521844-77521866
Sequence CCAGTCTTTCCTATTTAATTTAC AATCATTTATTTCATAATATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 446} {0: 1, 1: 1, 2: 7, 3: 68, 4: 678}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!