ID: 1193149900_1193149908

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1193149900 1193149908
Species Human (GRCh38) Human (GRCh38)
Location X:78114063-78114085 X:78114103-78114125
Sequence CCTGTGCCAACCCAGCTGCTGGG GAACCTCCGCTTTCATGTGGAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 4, 3: 33, 4: 385} {0: 2, 1: 1, 2: 1, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!