ID: 1193873379_1193873383

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1193873379 1193873383
Species Human (GRCh38) Human (GRCh38)
Location X:86829841-86829863 X:86829863-86829885
Sequence CCCAAATGTCAGTGTGTGTCCCT TCTTTTTAAGTTCTCAAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 219} {0: 1, 1: 0, 2: 3, 3: 28, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!