ID: 1194756830_1194756840

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1194756830 1194756840
Species Human (GRCh38) Human (GRCh38)
Location X:97747632-97747654 X:97747671-97747693
Sequence CCCGCTCATGCCTATCTAATTAC CAGGTTAATCAGGGAGATGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!