ID: 1195004886_1195004891

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1195004886 1195004891
Species Human (GRCh38) Human (GRCh38)
Location X:100676162-100676184 X:100676177-100676199
Sequence CCCCATTACTGATCCCTGAGGAG CTGAGGAGAAACACCAGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133} {0: 1, 1: 0, 2: 3, 3: 17, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!