ID: 1195050762_1195050768

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1195050762 1195050768
Species Human (GRCh38) Human (GRCh38)
Location X:101094644-101094666 X:101094681-101094703
Sequence CCGAAAAAGCATTGGTGCCCTTG ATCGTCATGACCCTTGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109} {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!