ID: 1195066400_1195066405

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1195066400 1195066405
Species Human (GRCh38) Human (GRCh38)
Location X:101242033-101242055 X:101242066-101242088
Sequence CCTGGACTACAACTGAGTTGCTG TGCTAGATTTGGGGCTGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123} {0: 1, 1: 1, 2: 6, 3: 26, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!