ID: 1195165437_1195165442

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1195165437 1195165442
Species Human (GRCh38) Human (GRCh38)
Location X:102215235-102215257 X:102215255-102215277
Sequence CCCTCTCTTCCTGGCTACAATGG TGGTACTTCCCAGACCAGGTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 247} {0: 2, 1: 0, 2: 2, 3: 7, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!