ID: 1195193416_1195193428

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1195193416 1195193428
Species Human (GRCh38) Human (GRCh38)
Location X:102471836-102471858 X:102471882-102471904
Sequence CCAACCTGGTCTGGGAAGTACCA ATCATCAGGGAGGAGTAGGACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 7, 4: 137} {0: 2, 1: 0, 2: 2, 3: 19, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!