ID: 1195596267_1195596272

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1195596267 1195596272
Species Human (GRCh38) Human (GRCh38)
Location X:106693765-106693787 X:106693781-106693803
Sequence CCTGGTTAAGGGTTACCTGTGTG CTGTGTGTACAGCTGGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 40, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!