ID: 1195649746_1195649752

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1195649746 1195649752
Species Human (GRCh38) Human (GRCh38)
Location X:107272587-107272609 X:107272611-107272633
Sequence CCGCGACTCGTACCATCACTATT CTACGACTATGACGGCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44} {0: 1, 1: 1, 2: 0, 3: 1, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!