ID: 1195755046_1195755052

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1195755046 1195755052
Species Human (GRCh38) Human (GRCh38)
Location X:108191827-108191849 X:108191852-108191874
Sequence CCTGGGGCCAGCTGTACCATTTC GGTGGCTGCTTTAAAAACATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!