ID: 1196411518_1196411522

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1196411518 1196411522
Species Human (GRCh38) Human (GRCh38)
Location X:115424940-115424962 X:115424966-115424988
Sequence CCAAATCATATCAGAGGGCATAG CCCAGAGAGAAGTGGATGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 438} {0: 1, 1: 0, 2: 1, 3: 34, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!