ID: 1196645714_1196645720

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1196645714 1196645720
Species Human (GRCh38) Human (GRCh38)
Location X:118116241-118116263 X:118116267-118116289
Sequence CCGGGTTCTGGGGTCCTAGAAGA CAGGCGTCCGACGGAGCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 185} {0: 1, 1: 0, 2: 1, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!