ID: 1196697619_1196697620

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1196697619 1196697620
Species Human (GRCh38) Human (GRCh38)
Location X:118630381-118630403 X:118630405-118630427
Sequence CCGACAGAGTTCTACAAGGAGTA TGTATCCCAGTATAACCGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 122} {0: 1, 1: 1, 2: 0, 3: 0, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!