ID: 1196775560_1196775572

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1196775560 1196775572
Species Human (GRCh38) Human (GRCh38)
Location X:119333929-119333951 X:119333966-119333988
Sequence CCTGCTCTACTGCGGCCAGTCCC GGCTGAGGAGTGCGGGCGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 32, 3: 489, 4: 802} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!