ID: 1196876312_1196876322

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1196876312 1196876322
Species Human (GRCh38) Human (GRCh38)
Location X:120158482-120158504 X:120158503-120158525
Sequence CCCCCCCACACCACCAACGCGTG TGCTCTCCCTCATCCGGGCAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 176} {0: 2, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!